The mature β cells in the KO and YIPF5Ile98Ser grafts showed a 3.3- and 3-fold reduction, respectively, in the percentage of cytoplasmic insulin-positive area, and a 5.7- and 5.4-fold increase, respectively, in the proinsulin area (Figure 5, D and G). Google Scholar, Find articles by in: Positive clones were confirmed using Sanger sequencing at Eurofins Genomics, and the sequences were aligned using Geneious Prime 2020.1.1. (D and E) EndoC-βH1 cells were transfected with 2 siRNAs against YIPF5 (si1 and si2) or control siRNA (siCT) for 48 hours and exposed or not (CTL) to thapsigargin (Tha) for 40 hours or brefeldin A (BFA) for 16 hours (n = 4). | JCI However, ESCp. PBMCs were obtained from patients IIIa and IIIb, who are both homozygous for the p.(Ile98Ser) mutation, and reprogrammed into iPSCs using Sendai virus. No signal was detected when the sense probe was used (negative control, left). JCI Johnson MB, et al. Authorship note: EDF, ML, HI, HM, MNW, and FF contributed equally to this work. Email or Phone: Password: Forgot account? 16Welbio, Université Libre de Bruxelles, Brussels, Belgium. |, Find articles by | No significant signal was observed with sense probes, confirming the specificity of the findings (Figure 2B). Google Scholar, Find articles by Transplantation of differentiated cells. Google Scholar Error bars represent SD from the mean. PubMed exemple de lettre de motivation pour aide soignante, lettre de relance pour une demande de logement, lettre de partenariat commercial gratuite, modele lettre avertissement travail mal fait, modele lettre exoneration taxe habitation. Patient IV’s father, who was diagnosed with type 2 diabetes and was being treated with oral hypoglycemic agents, was the only one of the patients’ parents to be affected with diabetes. HV and EJ performed the electron microscopic analyses. toutes les réponses pour lettre: changement poste cause maladie professionelle. Survival of β cells was evaluated under basal condition and following exposure to the ER stressors brefeldin A (which blocks ER-to-Golgi transport) and thapsigargin (which inhibits the sarco/endoplasmic reticulum Ca2+ ATPase [SERCA]). The overlap between genes causing diabetes and neurological features highlights shared pathways that are critically important for development (CNOT1, PTF1A, NEUROD1, MNX1, and NKX2-2) and function (ABCC8, KCNJ11, EIF2AK3, SLC19A2, IER3IP1, WFS1, TRMT10A, PPP1R15B, EIF2S3) of both β cells and neurons. The percentage of cytoplasmic area stained for proinsulin per β cell of the KO was 5.5-fold higher than in their WT counterparts, while the percentage of insulin area was 70% less in the KO β cells (Figure 4C). Other studies did not detect delayed anterograde cargo transport when silencing YIPF5 expression and instead found evidence for a role of YIPF5 in retrograde Golgi-to-ER transport (30, 31). Scale bars: 25 μm. P2008/313). Data points represent independent experiments. Briefly, aggregates equivalent to approximately 3 million cells were loaded on PE-50 tubing and transplanted under the kidney capsule. Skopkova M, et al. in: Karyotyping was done at the Institute of Pathology and Genetics, Gosselies, Belgium. Five individuals (II, IIIa, IIIb, IV, and V) were reported to have severe developmental delay, while neuromotor development was reported to be normal in patient I, who was 5 years of age at time of writing. After overnight transfection, cells were cultured at least 8 hours before treatment. The YIPF5Ile98Ser β cells showed a much milder phenotype with 20% less insulin area and a 1.7-fold increase in proinsulin area compared with the WT; however, the differences were not statistically significant. Suzuki, I. An isogenic control for the patient iPSCs was generated using a 21-base guide, CCAGATGTGGTCAAAATTGCT, while the guide for introducing the mutation in H1 was CCAGATGTGGTCAAAATTGAT. Google Scholar, Find articles by in: This Joint Undertaking receives support from the Union’s Horizon 2020 research and innovation programme and the European Federation of Pharmaceutical Industries and Associations, JDRF, and the Leona M. and Harry B. Helmsley Charitable Trust (to PM, DLE, TO, and MC). Having two C677T variants and elevated homocysteine levels may cause a slightly higher risk for blood clots. This siRNA does not affect β cell gene expression, function, or viability (54). absence - nezvestnosť - absencia - roztržitosť - nedostatok - neprítomnosť - neúčasť - nepozornosť - zamyslenosť - chýbanie niečoho - náhla a krátka strata pamäti - nedostávanie sa niečoho . We next investigated whether YIPF5 deficiency affects ER stress signaling by measuring mRNA expression of CHOP, spliced XBP1 (sXBP1), BiP, PDIA4, and HYOU1, which act in the 3 canonical branches of the ER stress response (downstream of PERK, IRE1, and ATF6, respectively). ATH, BH, MNO, EU, RY, TG, MY, KP, and BA analyzed the clinical data. Taken together, these results show that YIPF5 deficiency potentiates the ER stress response. EDF, MBJ, SEF, CJ, VS, and KP analyzed the genetic data. PubMed We therefore focused our analysis on homozygous rare coding variants in shared genes. A β cell–specific knockout of cTAGE5, a TANGO1-interacting protein, has been previously shown to impair proinsulin trafficking, induce ER stress, and cause impaired glucose tolerance in mice (49). Neither variant was listed in the gnomAD database (>120,000 individuals [ref. in: Konrad K, et al. PubMed 5Endocrinology and Metabolism, Department of Medicine and Surgery, University of Parma, Parma, Italy. Scale bars: 25 μm. Palmitate induces a pro-inflammatory response in human pancreatic islets that mimics CCL2 expression by beta cells in type 2 diabetes. The clinical features of the 6 patients are summarized in Table 1. PubMed in: The insulin-positive KO cells sustained high BiP expression in vivo, consistent with persistent ER stress. PubMed | Google Scholar Google Scholar | | | We believe this is the first report of mutations disrupting the ER-to-Golgi trafficking, resulting in diabetes. Huntington disease is a progressive brain disorder that causes uncontrolled movements, emotional problems, and loss of thinking ability (cognition).Adult-onset Huntington disease, the most common form of this disorder, usually appears in a person's thirties or forties. The only gene in common in both individuals was YIPF5, with patient I being homozygous for a missense, p.(Ala181Val), and patient II harboring a homozygous in-frame deletion variant, p.(Lys106del). |, Find articles by | JCI in: Identifying genes that result in monogenic diabetes can provide insights that can build a scientific foundation for precision medicine. Google Scholar, Find articles by modèle gratuit de lettre pour demander à changer de poste ou de service en ni pour une cause prévue par le code du travail (comme pour une grossesse,
One potential explanation for YIPF5’s essential role in β cell survival is its interaction with components of the COPII vesicle coat protein complex (sec23 and sec24) that mediates COPII-dependent export and the anterograde transport from the ER to the Golgi (33). All these mutations are predicted to be deleterious; however, it is possible that function of the YIPF5 protein is not completely lost. The expression pattern of YIPF5 during brain development was examined by in situ hybridization in human fetal brain samples encompassing stages 12 to 21 gestational weeks (Figure 2B and data not shown). PubMed JCI | Patients’ PBMCs were obtained after written informed consent was given by patients or parents with approval by the Erasmus Hospital Ethics Committee (ref. In this issue of the JCI, De Franco and Lytrivi et al. A 15-fold increase was detected in the number of cells with high BiP immunoreactivity (INS+BiPhi) in the KO (Figure 4, B and D; and Supplemental Figure 6B), likely reflecting ER stress response triggered by proinsulin retention in the ER. in: No difference was detected in the number of TUNEL+ cells in the grafts (data not shown). PubMed Explore symptoms, inheritance, genetics of this condition. We identified 3 homozygous YIPF5 missense mutations, p.(Ile98Ser), p.(Trp218Arg), and p.(Gly97Val), in 3 cases. |, Find articles by | Demarez, C. This is not surprising, as β cells and neurons have key genes and cellular functions in common (10, 11). DMSO was used as a vehicle control at 5 μL/mL. | Adzhubei IA, et al. In this study, we used genome sequencing to identify recessive pathogenic variants in YIPF5 as the genetic cause of a congenital syndrome characterized by neonatal/early-onset diabetes, severe microcephaly, and epilepsy. JCI Reference information: J Clin Invest. Loss of β cell function after in vivo implantation. Comprehensive statistical study of 452 BRCA1 missense substitutions with classification of eight recurrent substitutions as neutral. PubMed YIPF5 is expressed during human brain development, in adult brain and pancreatic islets. The genetic study in the Exeter Molecular Genetics Laboratory was conducted in accordance with the Declaration of Helsinki, and all patients or their parents gave informed consent for genetic testing. | EDF, ML, HI, HM, FF, JSV, ATH, MC, TO, PM, and DLE planned the experiments. Google Scholar, Find articles by 1Institute of Biomedical and Clinical Science, University of Exeter Medical School, Exeter, United Kingdom. (B) Schematic representation of the YIPF5 ER transmembrane protein using the CCTOP in silico predictor (http://cctop.enzim.ttk.mta.hu/). The BH3-only proteins PUMA (also known as BBC3), DP5 (also known as HRK), and BIM (also known as BCL2L11) activate apoptosis downstream of ER stress, playing a central role in β cell demise (26–29). Pathogenic variants in 8 genes known to be involved in regulating the ER stress response have been found to cause diabetes (ranging from neonatal to adolescent/adult-onset diabetes), often associated with neurological features (6, 16). Kalender Many translated example sentences containing "pour cause de mutation" – English-French dictionary and search engine for English translations. Google Scholar |, Find articles by Taguchi Y, Horiuchi Y, Kano F, Murata M. Novel prosurvival function of Yip1A in human cervical cancer cells: constitutive activation of the IRE1 and PERK pathways of the unfolded protein response. The mutational constraint spectrum quantified from variation in 141,456 humans. JCI The percentage of β cells of the human islet preparations was 59% ± 5%, as determined by insulin immunofluorescence. *P < 0.05, **P < 0.01, ***P < 0.001 vs. siCT in respective condition; ##P < 0.01, ###P < 0.001 for treated vs. untreated cells; †††P < 0.001 as indicated. iPSCs from patients IIIa and IIIb differentiated into β cells are sensitive to ER stress–induced apoptosis. EndoC-βH1 cells were preincubated in DMEM containing 2.8 mM glucose for 24 hours, followed by incubation in glucose-free Krebs solution for 1 hour. Genome sequencing was performed for 2 unrelated probands diagnosed with neonatal diabetes, epilepsy, and severe microcephaly (patients I and II in Table 1 and Figure 1A) in whom mutations in known neonatal diabetes genes had been excluded. | Taguchi Y, et al. Aggregates were incubated sequentially in 3.3 mM glucose, 20 mM glucose, and 3.3 mM plus 30 mM KCl for periods of 30 minutes. Paired 2-way ANOVA or mixed-model analysis (in case of missing values) followed by Bonferroni post hoc test. Ellard S, et al. (F) Static glucose-stimulated insulin secretion at stage 7 normalized to micrograms DNA of β cells (n = 3–7). Copy number variants were called by SavvyCNV, which uses read depth to judge copy number states. In HeLa cells, YIPF5 has been shown to interact with and promote IRE1 oligomerization and phosphorylation and enhance downstream XBP1 splicing upon tunicamycin exposure or infection with Brucella abortus (38). YIPF5 depletion did not impact β cell function: glucose- and forskolin-stimulated insulin secretion was comparable in YIPF5-depleted and -competent EndoC-βH1 cells, as was insulin content (Figure 3, B and C). ER whorling and partial Golgi fragmentation have also been observed in in vitro models of YIPF5 depletion, suggesting a role of YIPF5 in ER and Golgi structure maintenance (30, 32–34). en conséquence, si vous rencontrez un problème médical à cause de votre de proposer une mutation à un poste convenant mieux à votre état de santé. in: in: sequenced the genome of two probands with a rare neonatal diabetes subtype that also associated with microcephaly and epilepsy. Ibrahim, H. Google Scholar Brozzi F, et al. YIPF5 was efficiently silenced using 2 different siRNAs by 50%–75% at the mRNA level (Figure 3A and Supplemental Figure 2) and by approximately 50% at the protein level (n = 2–4). Unal, E. | (F–H) Immunohistochemistry of grafts for glucagon (GCG) and insulin (INS) (F), proinsulin (PROINS) and insulin (INS) (G), and BiP and insulin (INS) (H) 3 months after implantation.